Nerissa Alviana

Deteksi White Spot Syndrome Virus Secara Molekuler

Posted: May 13th 2014

 

Deteksi White Spot Syndrome Virus Secara Molekuler

 

Serangan penyakit pada udang windu (Penaeus monodon) oleh White Spot Syndrome Virus (WSSV), famili Nimaviridae. WSSV adalah penyakit viral yang sangat virulen dan dapat menyerang berbagai jenis udang (Lightner 1996). Penyakit ini dikenal dengan nama penyakit bintik putih pada udang. Virus ini bereplikasi di nukleus, berbentuk ellipsoid sampai basil, beramplop dengan ukuran 270-120 nm, memiliki ekor di salah satu kutub partikel virus. Serangan virus white spot dapat menyebabkan udang menjadi lemah dan gejala klinis yang nampak antara lain usus kosong, tubuh pucat, dan kemerah-merahan serta muncul bercak putih dengan diameter 0,5-2 mm pada bagian cephalotorax sampai menyebar keseluruh tubuh.

udang white spot

Gambar 1. Penyakit white spot

Virus ini menyerang udang windu pada tahap pemberasan yaitu pada umur 1-2 bulan dan virus dapat dengan cepat tersebar, hingga menyebabkan kematian. Penyebabran penyakit WSSV dapat disebabkan oleh adanya organisme carrier, yaitu organisme pembawa penyakit yang dapat menularkan penyakit pada organisme lainnya, tetapi organisme carrier tersebut tidak menunjukkan gejala klinis penyakitnya. Penularan penyakit pada udang windu dapat melalui organisme carrier, seperti rebon, udang putih, kepiting, dan udang windu itu sendiri.

Salah satu cara untuk mendiagnosa penyakit WSSV tersebut dapat dilakukan dengan deteksi gen dari agent pembawa penyakit tersebut dengan menggunakan PCR (Polymerase Chain Reaction). Metode PCR ini menggunakan alat Thermal Cycler PCR yang mempu mengamplifikasi fragmen DNA secara in vitro. Langkah awal yang perlu dilakukan adalah mengisolasi DNA sampel kepiting yang tersedia, yaitu bagian insangnya. Kemudian, dilakukan pemeriksaan dengan metode PCR. Amplifikasi DNA target ini dimaksudkan untuk meningkatkan jumlah DNA target yang ada, sehingga dapat dideteksi dengan elektroforesis. Proses amplifikasi ini perlu adanya sampel positif yang telah diketahui mengandung virus WSSV dan control negatifnya. Menurut Haliman (2004), kontrol positif menggunakan plasmid DNA WSSV, sehingga setelah proses elektroforesis berakhir, akan tampak pita-pita DNA sesuai dengan konsentrasi plasmid yang dipakai. Pada lajur kontrol negatif, setelah proses elektroforesis selesai akan tampak bersih tanpa ada  pita-pita DNA.

Hasil amplifikasi DNA dengan PCR tersebut, keberadaan DNA dilakukan pada akhir reaksi dengan menggunakan gel agarose setelah dilakukan proses elektroforesis. Setelah proses running selesai, gel tersebut perlu diamati di atas UV trans illuminator dan didokumentasikan dengan kamera digital. Keberadaan WSSV ditentukkan oleh desain primer yang digunakan, karena ukuran DNA denom WSSV berukuran besar, maka didesain fragmen dengan ukuran tertentu untuk mendeteksi keberadaan WSSV ini. Amplikikasi sekuen DNA WSSV digunakan 1 pasang primer yang berbeda urutan nukleotidanya. Primer tersebut adalah WSSV270 (5’ACCATGGAGAAGATATGTACAAGCA3’) dan primer WSSV345 (5’GGCATGGACAGTCAGGTCTTT3’) yang akan menghasilkan ukuran produk amplikon 76 bp.

Daftar Pustaka

Haliman, R.W. 2004. White Spot Syndrome Virus (WSSV) dan Bakteri Vibrio sp. Pada Pakan Segar yang DIberikan Sebagai Ransum Induk Udang Windu, Penaeus monodon. Jurnal Akuakultur Indonesia. Vol. 3(1):19-22.

Lightner, D.V. (Ed.). 1996. A Handbook of Pathology and Diagnostic Procedures for Diseases of Penaeid Shrimp. World Aquaculture Society, Baton Rouge. Louisiana.

Pranawaty, R.N., Buwono, I.D., dan Liviawaty, E. 2012. Aplikasi Polymerase Chain Reaction (PCR) Konvensional dan Real Time PCR Untuk Deteksi White Spot Syndrome Virus Pada Kepiting. Jurnal Perikanan dan Kelautan. Vol. 3(4):61-74.


3 responses to “Deteksi White Spot Syndrome Virus Secara Molekuler”

  1. andreyoga says:

    Menarik, mungkin dapat ditampilkan hasil elektroforesisnya

  2. maria says:

    wah, ada yang baru ni..
    menarik

  3. elisabeth toby says:

    Sangat menambahn wawasan nona nerisa alviana…

Leave a Reply

Your email address will not be published. Required fields are marked *

© 2021 Universitas Atma Jaya Yogyakarta
css.php